Skip to main content

TLCV2-ApaLI-T2A-EGFP-Puro
(Plasmid #234948)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 234948 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    TLCV2
  • Backbone manufacturer
    Adam Karpf (Addgene #87360)
  • Modifications to backbone
    removal of sgRNA and Cas9
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ApaLI restriction enzyme with N-terminal COX8 mitochondrial localization signal
  • Alt name
    mito-ApaLI
  • Promoter tight TRE promoter
  • Tag / Fusion Protein
    • FLAG (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site AscI (not destroyed)
  • 5′ sequencing primer NA
  • 3′ sequencing primer CGTCGCCGTCCAGCTCGACCA
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    pcDNA3_mitoApaLI (from Bayona-Bafaluy, et al. PMID: 16179392) was generously shared by Carlos T Moraes.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    TLCV2-ApaLI-T2A-EGFP-Puro was a gift from Agnel Sfeir (Addgene plasmid # 234948 ; http://n2t.net/addgene:234948 ; RRID:Addgene_234948)
  • For your References section:

    Engineering mtDNA Deletions by Reconstituting End-Joining in Human Mitochondria. Fu Y, Land M, Cui R, Kavlashvili T, Kim M, Lieber T, Ryu KW, DeBitetto E, Masilionis I, Saha R, Takizawa M, Baker D, Tigano M, Reznik E, Sharma R, Chaligne R, Thompson CB, Pe'er D, Sfeir A. bioRxiv [Preprint]. 2024 Oct 17:2024.10.15.618543. doi: 10.1101/2024.10.15.618543. 10.1101/2024.10.15.618543 PubMed 39463974