TLCV2-Scal-T2A-EGFP-Puro
(Plasmid
#234949)
-
PurposeDoxycycline-inducible mitochondria-localized ScaI expressing plasmid
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 234949 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneTLCV2
-
Backbone manufacturerAdam Karpf (Addgene #87360)
-
Modifications to backboneremoval of sgRNA and Cas9
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameScaI restriction enzyme with N-terminal COX8 mitochondrial localization signal
-
Alt namemito-ScaI
- Promoter tight TRE promoter
-
Tag
/ Fusion Protein
- FLAG (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer NA
- 3′ sequencing primer CGTCGCCGTCCAGCTCGACCA
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bypcDNA_mitoScaI (from Bacman, et al. PMID: 19435881) was generously shared by Carlos T Moraes.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
TLCV2-Scal-T2A-EGFP-Puro was a gift from Agnel Sfeir (Addgene plasmid # 234949 ; http://n2t.net/addgene:234949 ; RRID:Addgene_234949) -
For your References section:
Engineering mtDNA Deletions by Reconstituting End-Joining in Human Mitochondria. Fu Y, Land M, Cui R, Kavlashvili T, Kim M, Lieber T, Ryu KW, DeBitetto E, Masilionis I, Saha R, Takizawa M, Baker D, Tigano M, Reznik E, Sharma R, Chaligne R, Thompson CB, Pe'er D, Sfeir A. bioRxiv [Preprint]. 2024 Oct 17:2024.10.15.618543. doi: 10.1101/2024.10.15.618543. 10.1101/2024.10.15.618543 PubMed 39463974