Skip to main content

pHAGE2-EF1a-E1MLS-2xFLAG-LigD-IRES-tdTomato
(Plasmid #234951)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 234951 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pHAGE2-EF1a-MCS-IRES-tdTomato
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Human codon optimized LigD with N-terminal mitochondrial localization signal of pyruvate dehydrogenase E1 subunit
  • Alt name
    mito-LigD
  • Species
    Mycobacterium tuberculosis
  • Promoter EF1A
  • Tag / Fusion Protein
    • FLAG (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Eco53kI (unknown if destroyed)
  • 3′ cloning site PmeI (not destroyed)
  • 5′ sequencing primer CGTCCAGGCACCTCGATTAG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHAGE2-EF1a-E1MLS-2xFLAG-LigD-IRES-tdTomato was a gift from Agnel Sfeir (Addgene plasmid # 234951 ; http://n2t.net/addgene:234951 ; RRID:Addgene_234951)
  • For your References section:

    Engineering mtDNA Deletions by Reconstituting End-Joining in Human Mitochondria. Fu Y, Land M, Cui R, Kavlashvili T, Kim M, Lieber T, Ryu KW, DeBitetto E, Masilionis I, Saha R, Takizawa M, Baker D, Tigano M, Reznik E, Sharma R, Chaligne R, Thompson CB, Pe'er D, Sfeir A. bioRxiv [Preprint]. 2024 Oct 17:2024.10.15.618543. doi: 10.1101/2024.10.15.618543. 10.1101/2024.10.15.618543 PubMed 39463974