pHAGE2-EF1a-E1MLS-2×FLAG-T4Lig-IRES-tdTomato
(Plasmid
#234952)
-
PurposeHuman codon optimized T4 DNA Ligase with N-terminal E1 MLS expressing plasmid
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 234952 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepHAGE2-EF1a-MCS-IRES-tdTomato
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehuman codon optimized T4 DNA Ligase with N-terminal mitochondrial localization signal of pyruvate dehydrogenase E1 subunit
-
Alt namemito-T4
-
SpeciesEnterobacteria phage T4 (Bacteriophage T4)
- Promoter EF1a
-
Tag
/ Fusion Protein
- FLAG (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (not destroyed)
- 3′ cloning site BmtI (not destroyed)
- 5′ sequencing primer CGTCCAGGCACCTCGATTAG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHAGE2-EF1a-E1MLS-2×FLAG-T4Lig-IRES-tdTomato was a gift from Agnel Sfeir (Addgene plasmid # 234952 ; http://n2t.net/addgene:234952 ; RRID:Addgene_234952) -
For your References section:
Engineering mtDNA Deletions by Reconstituting End-Joining in Human Mitochondria. Fu Y, Land M, Cui R, Kavlashvili T, Kim M, Lieber T, Ryu KW, DeBitetto E, Masilionis I, Saha R, Takizawa M, Baker D, Tigano M, Reznik E, Sharma R, Chaligne R, Thompson CB, Pe'er D, Sfeir A. bioRxiv [Preprint]. 2024 Oct 17:2024.10.15.618543. doi: 10.1101/2024.10.15.618543. 10.1101/2024.10.15.618543 PubMed 39463974