pBAC-T7-F7
(Plasmid
#234973)
-
PurposeA segment of the T7 phage genome was inserted into the artificial bacterial chromosome . The genome segment can be stably replicated in plasmid and can be genetically modified at the plasmid level
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 234973 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneArtificial bacterial chromosome
- Backbone size w/o insert (bp) 6205
- Total vector size (bp) 11276
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameT7-F7
-
Speciesbacteriophage
-
Insert Size (bp)5023
-
GenBank IDNC_001604
Cloning Information
- Cloning method Other
- 5′ sequencing primer atggctgctcgctaaacaag
- 3′ sequencing primer cctgtctacctttggtaacc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note: This plasmid contains a L227F mutation in SopA. This mutation is not known to impact plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBAC-T7-F7 was a gift from Hailong Wang (Addgene plasmid # 234973 ; http://n2t.net/addgene:234973 ; RRID:Addgene_234973)