p15A-ΦX174-F2
(Plasmid
#234978)
-
PurposeA segment of the ΦX174 phage genome was inserted into the p15A plasmid . The genome segment can be stably replicated in plasmid and can be genetically modified at the plasmid level
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 234978 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonep15A
- Backbone size w/o insert (bp) 1798
- Total vector size (bp) 5220
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namephix174-F2
-
Speciesbacteriophage
-
Insert Size (bp)3422
-
GenBank IDCP004084
Cloning Information
- Cloning method Other
- 5′ sequencing primer atggaaggcgctgaatttac
- 3′ sequencing primer agcattggggattgagaaag (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p15A-ΦX174-F2 was a gift from Hailong Wang (Addgene plasmid # 234978 ; http://n2t.net/addgene:234978 ; RRID:Addgene_234978)
Map uploaded by the depositor.
