hDNMT3B_KO_puro
(Plasmid
#234998)
-
PurposeStable knockout of DNMT3B function in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 234998 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepLV[CRISPR]-hCas9
- Total vector size (bp) 11687
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehCas9
-
Alt nameS. pyogenes Cas9
-
gRNA/shRNA sequenceTGCTGTTGCCCGCCGTCTCA
-
SpeciesH. sapiens (human)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer acgatacaaggctgttagagaga (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
hDNMT3B_KO_puro was a gift from Samrat Roy Choudhury (Addgene plasmid # 234998 ; http://n2t.net/addgene:234998 ; RRID:Addgene_234998)