Skip to main content

Scramble_gRNA_puro
(Plasmid #234999)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 234999 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLV[gRNA]-EGFP
  • Total vector size (bp) 8485
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    scramble sgRNA
  • gRNA/shRNA sequence
    GCACTACCAGAGCTAACTCA
  • Species
    H. sapiens (human)
  • Tag / Fusion Protein
    • EGFP:T2A:Puro

Cloning Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Scramble_gRNA_puro was a gift from Samrat Roy Choudhury (Addgene plasmid # 234999 ; http://n2t.net/addgene:234999 ; RRID:Addgene_234999)
  • For your References section:

    Transcriptional rewiring by enhancer methylation in CBFA2T3-GLIS2-driven pediatric acute megakaryoblastic leukemia. Choudhury SR, Kaushal A, Biswas P, Padilla C, Sarthy JF, Chavan A, Gonzalez GA, Meshinchi S, Farrar JE. Genes Dis. 2025 Sep 6;13(1):101843. doi: 10.1016/j.gendis.2025.101843. eCollection 2026 Jan. 10.1016/j.gendis.2025.101843 PubMed 41141393