Skip to main content

VN515 pBR-rpoA-IP1
(Plasmid #235098)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 235098 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pBR
  • Backbone size w/o insert (bp) 5094
  • Vector type
    Bacterial Expression, Synthetic Biology ; Quantitative bacterial two-hybrid (qB2H)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    SB39 (Addgene #235121)
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    IP1
  • Species
    Synthetic
  • Insert Size (bp)
    72
  • Promoter lpp+lacUV5
  • Tag / Fusion Protein
    • rpoA (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer GAACAGCGTACCGACCTGGAC
  • 3′ sequencing primer CAGTAGTAGGTTGAGGCCGTT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note that this plasmid may require a unique bacterial strain, so make sure to confirm that you can also obtain the appropriate growth strain. Please contact us at [email protected] or contact our distributors if you have any questions. Please visit https://doi.org/10.1101/2025.10.29.680610 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    VN515 pBR-rpoA-IP1 was a gift from Oscar Ramos (Addgene plasmid # 235098 ; http://n2t.net/addgene:235098 ; RRID:Addgene_235098)
  • For your References section:

    Optimized quantitative bacterial two-hybrid (qB2H) for protein-protein interaction assessment. Guyot A, Maillard E, Ferreira-Pinto K, Plancon-Arnould L, Nadaradjane AA, Ochsenbein F, Guerois R, Martin L, Ramos OHP. bioRxiv 2025.10.29.680610 10.1101/2025.10.29.680610