VN518 pBR-rpoA-IP4
(Plasmid
#235101)
-
PurposeQuantitative bacterial two-hybrid (qB2H). Expresses IP4.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 235101 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBR
- Backbone size w/o insert (bp) 5094
-
Vector typeBacterial Expression, Synthetic Biology ; Quantitative bacterial two-hybrid (qB2H)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)SB39 (Addgene #235121)
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameIP4
-
SpeciesSynthetic
-
Insert Size (bp)93
- Promoter lpp+lacUV5
-
Tag
/ Fusion Protein
- rpoA (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer GAACAGCGTACCGACCTGGAC
- 3′ sequencing primer CAGTAGTAGGTTGAGGCCGTT
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note that this plasmid may require a unique bacterial strain, so make sure to confirm that you can also obtain the appropriate growth strain. Please contact us at [email protected] or contact our distributors if you have any questions. Please visit https://doi.org/10.1101/2025.10.29.680610 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
VN518 pBR-rpoA-IP4 was a gift from Oscar Ramos (Addgene plasmid # 235101 ; http://n2t.net/addgene:235101 ; RRID:Addgene_235101) -
For your References section:
Optimized quantitative bacterial two-hybrid (qB2H) for protein-protein interaction assessment. Guyot A, Maillard E, Ferreira-Pinto K, Plancon-Arnould L, Nadaradjane AA, Ochsenbein F, Guerois R, Martin L, Ramos OHP. bioRxiv 2025.10.29.680610 10.1101/2025.10.29.680610