VN999 pB2Hws_v9_cI-Asf1B+rpoA-IP3mut3A
(Plasmid
#235104)
-
PurposeQuantitative bacterial two-hybrid (qB2H). Expresses Asf1B and IP3mut3A.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 235104 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAC
- Backbone size w/o insert (bp) 6519
-
Vector typeBacterial Expression, Synthetic Biology ; Quantitative bacterial two-hybrid (qB2H)
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)SB39 (Addgene #235121)
-
Growth instructionsResistant to kanamycin (dependent on the interaction strength)
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert nameAsf1B
-
Alt nameAnti-silencing function protein 1 homolog B
-
Alt nameCCG1-interacting factor A-II
-
SpeciesH. sapiens (human)
-
Insert Size (bp)483
-
Entrez GeneASF1B (a.k.a. CIA-II)
- Promoter lacUV5
-
Tag
/ Fusion Protein
- cI_E34P-rpoA (N terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site Acc65I (not destroyed)
- 3′ cloning site SacI (not destroyed)
- 5′ sequencing primer GATCAGGGATAGCGGTCAGG
- 3′ sequencing primer TCCCCGTGGAGGTAATAATTGAC
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameIP3mut3A
-
Insert Size (bp)93
- Promoter lpp+lacUV5
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer GAACAGCGTACCGACCTGGAC
- 3′ sequencing primer AAGTTGGCCCAGGGCT
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note that this plasmid may require a unique bacterial strain, so make sure to confirm that you can also obtain the appropriate growth strain. Please contact us at [email protected] or contact our distributors if you have any questions. Please visit https://doi.org/10.1101/2025.10.29.680610 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
VN999 pB2Hws_v9_cI-Asf1B+rpoA-IP3mut3A was a gift from Oscar Ramos (Addgene plasmid # 235104 ; http://n2t.net/addgene:235104 ; RRID:Addgene_235104) -
For your References section:
Optimized quantitative bacterial two-hybrid (qB2H) for protein-protein interaction assessment. Guyot A, Maillard E, Ferreira-Pinto K, Plancon-Arnould L, Nadaradjane AA, Ochsenbein F, Guerois R, Martin L, Ramos OHP. bioRxiv 2025.10.29.680610 10.1101/2025.10.29.680610