pX458-ITGB6
(Plasmid
#235244)
-
PurposeEncodes gRNA for human ITGB6
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 235244 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepX458-mCherry
-
Backbone manufacturerJoanna Wysocka (Addgene #161974)
-
Vector typeMammalian Expression, CRISPR
-
Selectable markersmCherry
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameITGB6
-
gRNA/shRNA sequenceCCAGACTGAGGACTACCCGG
-
SpeciesH. sapiens (human)
-
Entrez GeneITGB6 (a.k.a. AI1H)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX458-ITGB6 was a gift from Jan Carette (Addgene plasmid # 235244 ; http://n2t.net/addgene:235244 ; RRID:Addgene_235244) -
For your References section:
MYADM binds human parechovirus 1 and is essential for viral entry. Qiao W, Richards CM, Kim Y, Zengel JR, Ding S, Greenberg HB, Carette JE. Nat Commun. 2024 Apr 24;15(1):3469. doi: 10.1038/s41467-024-47825-0. 10.1038/s41467-024-47825-0 PubMed 38658526