pAAV-CAG-FLEX-jGCaMP8m-P2A-CyRFP1-WPRE
(Plasmid #235249)

• Purpose: AAV-mediated and Cre-dependent expression of jGCaMP8m and CyRFP1 in mammalian cells
• Depositing Lab: Takeshi Imai
• Publication: Egashira et al Sci Adv. 2026 Jan 16;12(3):eadw8458. doi: 10.1126/sciadv.adw8458. Epub 2026 Jan 14.

Want a viral vector made from this plasmid?

Make a packaging request and we'll get back to you.

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.

• Serotype: Select serotype for details See details about
• Pricing: Select serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
• How this works:
  • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
  • Addgene will quickly confirm that we can produce a high-quality prep for you.
  • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
  • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
  • Learn more about our Packaged on Request Service.

Backbone

• Vector backbone: pAAV
• Backbone size w/o insert (bp): 5209
• Total vector size (bp): 7183
• Vector type: Mammalian Expression, AAV, Cre/Lox

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: jGCaMP8m
• Species: Synthetic
• Insert Size (bp): 1272
• GenBank ID: OK646319
• Promoter: CAG

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: AACACCTTGCTCCCGTACAT

Gene/Insert 2

• Gene/Insert name: CyRFP1
• Species: Synthetic
• Insert Size (bp): 702
• GenBank ID: KX938331
• Promoter: CAG

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: cttgaggggctccgggaggg

Resource Information

• Supplemental Documents:
  • AAV-CAG-FLEX-GCamp8m-P2A-CyRFP-WPRE.ape

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry