pAAV-CAG-FLEX-jGCaMP8m-P2A-CyRFP1-WPRE
(Plasmid
#235249)
-
PurposeAAV-mediated and Cre-dependent expression of jGCaMP8m and CyRFP1 in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 235249 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepAAV
- Backbone size w/o insert (bp) 5209
- Total vector size (bp) 7183
-
Vector typeMammalian Expression, AAV, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namejGCaMP8m
-
SpeciesSynthetic
-
Insert Size (bp)1272
-
GenBank IDOK646319
- Promoter CAG
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer AACACCTTGCTCCCGTACAT
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameCyRFP1
-
SpeciesSynthetic
-
Insert Size (bp)702
-
GenBank IDKX938331
- Promoter CAG
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer cttgaggggctccgggaggg
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-CAG-FLEX-jGCaMP8m-P2A-CyRFP1-WPRE was a gift from Takeshi Imai (Addgene plasmid # 235249 ; http://n2t.net/addgene:235249 ; RRID:Addgene_235249) -
For your References section:
Dendritic compartment-specific spine formation in layer 5 neurons underlies cortical circuit maturation during adolescence. Egashira R, Ke MT, Nakagawa-Tamagawa N, Fujimoto S, Inagaki S, Takagi T, Miyakawa T, Tagawa Y, Imai T. Sci Adv. 2026 Jan 16;12(3):eadw8458. doi: 10.1126/sciadv.adw8458. Epub 2026 Jan 14. 10.1126/sciadv.adw8458 PubMed 41533795