Setd1a gRNA#1
(Plasmid
#235250)
-
PurposeCas9-mediated knockout of Setd1a in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 235250 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonegRNA backbone
- Backbone size w/o insert (bp) 2794
- Total vector size (bp) 2813
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSetd1a
-
gRNA/shRNA sequenceTGGTCCGCTCTACGACCCG
-
SpeciesM. musculus (mouse)
-
Entrez GeneSetd1a (a.k.a. KMT2F, Nsccn1, mKIAA0339, mNSC1)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TTCCCATGATTCCTTCATAT
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Setd1a gRNA#1 was a gift from Takeshi Imai (Addgene plasmid # 235250 ; http://n2t.net/addgene:235250 ; RRID:Addgene_235250) -
For your References section:
Dendritic compartment-specific spine formation in layer 5 neurons underlies cortical circuit maturation during adolescence. Egashira R, Ke MT, Nakagawa-Tamagawa N, Fujimoto S, Inagaki S, Takagi T, Miyakawa T, Tagawa Y, Imai T. Sci Adv. 2026 Jan 16;12(3):eadw8458. doi: 10.1126/sciadv.adw8458. Epub 2026 Jan 14. 10.1126/sciadv.adw8458 PubMed 41533795