Skip to main content

EFS-mGL-bGH
(Plasmid #235255)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 235255 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pShip.USI (upstream inverted)
  • Backbone manufacturer
    Galloway lab
  • Backbone size w/o insert (bp) 2046
  • Vector type
    Mammalian Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mGreenLantern
  • Alt name
    mGL
  • Species
    Aequorea victoria
  • Insert Size (bp)
    716
  • Promoter EFS (human EF1a short, intronless)

Cloning Information

  • Cloning method Golden Gate
  • 5′ sequencing primer CATCAGAGATTTTGAGACAC
  • 3′ sequencing primer gcgtttctacaaactcttcc
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Addgene #161912

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Alt name: pKG2352 ; Please visit https://doi.org/10.1101/2024.06.25.600629 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    EFS-mGL-bGH was a gift from Kate Galloway (Addgene plasmid # 235255 ; http://n2t.net/addgene:235255 ; RRID:Addgene_235255)
  • For your References section:

    Model-guided design of microRNA-based gene circuits supports precise dosage of transgenic cargoes into diverse primary cells. Love KS, Johnstone CP, Peterman EL, Gaglione S, Birnbaum ME, Galloway KE. Cell Syst. 2025 Apr 22:101269. doi: 10.1016/j.cels.2025.101269. 10.1016/j.cels.2025.101269 PubMed 40300600