EF1a-TS.FF6x1-mRuby2-miR.FF5-bGH
(Plasmid
#235280)
-
PurposeComMAND open-loop circuit regulating mRuby2 with miR-FF5 design 3
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 235280 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepShip.USI (upstream inverted)
-
Backbone manufacturerGalloway lab
- Backbone size w/o insert (bp) 2046
-
Vector typeMammalian Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemRuby2
-
SpeciesEntacmaea quadricolor
-
Insert Size (bp)711
- Promoter EF1a (human EF1a)
Cloning Information
- Cloning method Golden Gate
- 5′ sequencing primer CATCAGAGATTTTGAGACAC
- 3′ sequencing primer gcgtttctacaaactcttcc
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byAddgene #90236
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Alt name: pKG3153 ; Please visit https://doi.org/10.1101/2024.06.25.600629 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
EF1a-TS.FF6x1-mRuby2-miR.FF5-bGH was a gift from Kate Galloway (Addgene plasmid # 235280 ; http://n2t.net/addgene:235280 ; RRID:Addgene_235280) -
For your References section:
Model-guided design of microRNA-based gene circuits supports precise dosage of transgenic cargoes into diverse primary cells. Love KS, Johnstone CP, Peterman EL, Gaglione S, Birnbaum ME, Galloway KE. Cell Syst. 2025 Apr 22:101269. doi: 10.1016/j.cels.2025.101269. 10.1016/j.cels.2025.101269 PubMed 40300600