Skip to main content

pPB-[EF1a-mRuby2-bGH]-UbC-PuroR-T2A-mGL-SV40pA
(Plasmid #235325)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 235325 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    PiggyBac
  • Backbone manufacturer
    Addgene #63800
  • Backbone size w/o insert (bp) 1944
  • Vector type
    Mammalian Expression, Synthetic Biology ; PiggyBac
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mRuby2
  • Species
    Entacmaea quadricolor
  • Insert Size (bp)
    711
  • Promoter EF1a (human EF1a)

Cloning Information

  • Cloning method Golden Gate
  • 5′ sequencing primer cgtacgttaaagataatcatgcgt
  • 3′ sequencing primer CACCCTAGAAAGATAGTCTGCG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Addgene #90236

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Also expresses mGreenLantern and puromycin resistance genes; Alt name: pKG3806 ; Please visit https://doi.org/10.1101/2024.06.25.600629 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pPB-[EF1a-mRuby2-bGH]-UbC-PuroR-T2A-mGL-SV40pA was a gift from Kate Galloway (Addgene plasmid # 235325 ; http://n2t.net/addgene:235325 ; RRID:Addgene_235325)
  • For your References section:

    Model-guided design of microRNA-based gene circuits supports precise dosage of transgenic cargoes into diverse primary cells. Love KS, Johnstone CP, Peterman EL, Gaglione S, Birnbaum ME, Galloway KE. Cell Syst. 2025 Apr 22:101269. doi: 10.1016/j.cels.2025.101269. 10.1016/j.cels.2025.101269 PubMed 40300600