Skip to main content

pLentiCRISPRv2 Neo-MORC3_gRNA_1
(Plasmid #235529)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 235529 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLentiCRISPRv2-Neo
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    MORC3
  • gRNA/shRNA sequence
    GCTGATACTGAGATACCATA
  • Species
    H. sapiens (human)
  • Entrez Gene
    MORC3 (a.k.a. NXP2, ZCW5, ZCWCC3)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLentiCRISPRv2 Neo-MORC3_gRNA_1 was a gift from Nicolas Manel (Addgene plasmid # 235529 ; http://n2t.net/addgene:235529 ; RRID:Addgene_235529)
  • For your References section:

    Centromeric DNA amplification triggered by viral proteins activates nuclear cGAS. Lahaye X, Tran Van P, Chakraborty C, Shmakova A, Cao NTB, Ferran H, Ait-Mohamed O, Maurin M, Waterfall JJ, Kaufer BB, Fischer P, Hennig T, Dolken L, Lomonte P, Fachinetti D, Manel N. Cell. 2025 May 29:S0092-8674(25)00556-2. doi: 10.1016/j.cell.2025.05.008. 10.1016/j.cell.2025.05.008 PubMed 40460826