PX459_L31_CRISPR_upstream_sgRNA
(Plasmid
#235609)
-
PurposeEncodes CRISPR gRNA for cleaving upstream of insertion site at C terminus of mouse Rpl31
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 235609 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonePX459
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRpl31 C-terminus upstream sgRNA
-
gRNA/shRNA sequenceGATCTACAGACGGTCAACGT
-
SpeciesM. musculus (mouse)
Cloning Information
- Cloning method Other
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PX459_L31_CRISPR_upstream_sgRNA was a gift from Maria Barna (Addgene plasmid # 235609 ; http://n2t.net/addgene:235609 ; RRID:Addgene_235609) -
For your References section:
A subcellular map of translational machinery composition and regulation at the single-molecule level. Zhang Z, Xu A, Bai Y, Chen Y, Cates K, Kerr C, Bermudez A, Susanto TT, Wysong K, Garcia Marques FJ, Nolan GP, Pitteri S, Barna M. Science. 2025 Mar 7;387(6738):eadn2623. doi: 10.1126/science.adn2623. Epub 2025 Mar 7. 10.1126/science.adn2623 PubMed 40048539