Skip to main content

PX459_L31_CRISPR_downstream_sgRNA
(Plasmid #235610)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 235610 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    PX459
  • Vector type
    CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Rpl31 C-terminus downstream sgRNA
  • gRNA/shRNA sequence
    CATGGGTGGAATTTTTGGGT
  • Species
    M. musculus (mouse)

Cloning Information

  • Cloning method Other

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PX459_L31_CRISPR_downstream_sgRNA was a gift from Maria Barna (Addgene plasmid # 235610 ; http://n2t.net/addgene:235610 ; RRID:Addgene_235610)
  • For your References section:

    A subcellular map of translational machinery composition and regulation at the single-molecule level. Zhang Z, Xu A, Bai Y, Chen Y, Cates K, Kerr C, Bermudez A, Susanto TT, Wysong K, Garcia Marques FJ, Nolan GP, Pitteri S, Barna M. Science. 2025 Mar 7;387(6738):eadn2623. doi: 10.1126/science.adn2623. Epub 2025 Mar 7. 10.1126/science.adn2623 PubMed 40048539