P-d22bp
(Plasmid
#235657)
-
PurposeB. thetaiotaomicron fusA2 expression reporter lacking 22bp Cur binding site
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 235657 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepBolux
- Backbone size w/o insert (bp) 13807
- Total vector size (bp) 14085
-
Selectable markersconfers tetracycline resistance in Bacteroides thetaiotaomicron
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Pir1
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBacteroides thetaiotaomicron fusA2 promoter lacking the 22bp Cur binding site
-
SpeciesBacteroides thetaiotaomicron
-
Insert Size (bp)278
-
MutationThe B. thetaiotaomicron fusA2 promoter lacking "CCTTATGTTACATAACATTGTT"
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CGCCAGGGTTTTCCCAGTCACGAC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2024.11.13.623061 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
P-d22bp was a gift from Guy Townsend (Addgene plasmid # 235657 ; http://n2t.net/addgene:235657 ; RRID:Addgene_235657) -
For your References section:
Hierarchical glycolytic pathways control the carbohydrate utilization regulator in human gut Bacteroides. Kabonick S, Verma K, Modesto JL, Pearce VH, Winokur KM, Groisman EA, Townsend GE. bioRxiv [Preprint]. 2024 Nov 13:2024.11.13.623061. doi: 10.1101/2024.11.13.623061. 10.1101/2024.11.13.623061 PubMed 39605394