Skip to main content

P-d22bp
(Plasmid #235657)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 235657 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pBolux
  • Backbone size w/o insert (bp) 13807
  • Total vector size (bp) 14085
  • Selectable markers
    confers tetracycline resistance in Bacteroides thetaiotaomicron

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Pir1
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Bacteroides thetaiotaomicron fusA2 promoter lacking the 22bp Cur binding site
  • Species
    Bacteroides thetaiotaomicron
  • Insert Size (bp)
    278
  • Mutation
    The B. thetaiotaomicron fusA2 promoter lacking "CCTTATGTTACATAACATTGTT"

Cloning Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2024.11.13.623061 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    P-d22bp was a gift from Guy Townsend (Addgene plasmid # 235657 ; http://n2t.net/addgene:235657 ; RRID:Addgene_235657)
  • For your References section:

    Hierarchical glycolytic pathways control the carbohydrate utilization regulator in human gut Bacteroides. Kabonick S, Verma K, Modesto JL, Pearce VH, Winokur KM, Groisman EA, Townsend GE. bioRxiv [Preprint]. 2024 Nov 13:2024.11.13.623061. doi: 10.1101/2024.11.13.623061. 10.1101/2024.11.13.623061 PubMed 39605394