pLV_EF1a-NAE1_IRES_Puro
(Plasmid
#235659)
-
Purposehuman NAE1 cloned into into lentiviral backbone (pLV-EF1a-IRES-Puro)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 235659 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepLV-EF1a-IRES-Puro
- Backbone size w/o insert (bp) 8785
- Total vector size (bp) 10390
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameNAE1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1605
-
GenBank IDBC000480
-
Entrez GeneNAE1 (a.k.a. A-116A10.1, APPBP1, HPP1, NEDFIH, ula-1)
- Promoter EF1a
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (unknown if destroyed)
- 3′ cloning site NotI (unknown if destroyed)
- 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC
- 3′ sequencing primer GCATTCCTTTGGCGAGAG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bycDNA for cloning was purchased from sino biological (HG14282-G) and cloned into Plasmid #85132 provided by Addgene
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLV_EF1a-NAE1_IRES_Puro was a gift from Lorenz Studer (Addgene plasmid # 235659 ; http://n2t.net/addgene:235659 ; RRID:Addgene_235659) -
For your References section:
Genome-wide CRISPR screen identifies neddylation as a regulator of neuronal aging and AD neurodegeneration. Saurat N, Minotti AP, Rahman MT, Sikder T, Zhang C, Cornacchia D, Jungverdorben J, Ciceri G, Betel D, Studer L. Cell Stem Cell. 2024 Aug 1;31(8):1162-1174.e8. doi: 10.1016/j.stem.2024.06.001. Epub 2024 Jun 24. 10.1016/j.stem.2024.06.001 PubMed 38917806