Skip to main content

pLV_EF1aUBA3_IRES_Puro
(Plasmid #235660)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 235660 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLV-EF1a-IRES-Puro
  • Backbone size w/o insert (bp) 8785
  • Total vector size (bp) 10177
  • Modifications to backbone
    Insertion of UBA3
  • Vector type
    Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    UBA3
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1392
  • GenBank ID
    NM_003968.3
  • Entrez Gene
    UBA3 (a.k.a. NAE2, UBE1C, hUBA3)
  • Promoter EF1a

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (unknown if destroyed)
  • 3′ cloning site NotI (unknown if destroyed)
  • 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC
  • 3′ sequencing primer GCATTCCTTTGGCGAGAG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    cDNA for cloning was purchased from sino biological (HG16320-G) and cloned into Plasmid #85132 provided by Addgene

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLV_EF1aUBA3_IRES_Puro was a gift from Lorenz Studer (Addgene plasmid # 235660 ; http://n2t.net/addgene:235660 ; RRID:Addgene_235660)
  • For your References section:

    Genome-wide CRISPR screen identifies neddylation as a regulator of neuronal aging and AD neurodegeneration. Saurat N, Minotti AP, Rahman MT, Sikder T, Zhang C, Cornacchia D, Jungverdorben J, Ciceri G, Betel D, Studer L. Cell Stem Cell. 2024 Aug 1;31(8):1162-1174.e8. doi: 10.1016/j.stem.2024.06.001. Epub 2024 Jun 24. 10.1016/j.stem.2024.06.001 PubMed 38917806