pME_G_0_1_011_5C3SF
(Plasmid
#235791)
-
Purpose5' Connector 3 Short Forward in the M1 position used to dictate position for lvl2 assembly
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 235791 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepME_Cp_UAV_GFP
- Backbone size w/o insert (bp) 2101
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert name5' Connector 3 Short Forward
-
SpeciesSynthetic
-
Insert Size (bp)19
-
Mutationnone
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (destroyed during cloning)
- 3′ cloning site BsaI (destroyed during cloning)
- 5′ sequencing primer CGTATCACGAGGCAGAATTTC
- 3′ sequencing primer CCTGCATAACGCGAAGTAATC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2024.05.08.593163 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pME_G_0_1_011_5C3SF was a gift from Tobias Erb (Addgene plasmid # 235791 ; http://n2t.net/addgene:235791 ; RRID:Addgene_235791) -
For your References section:
Advancing chloroplast synthetic biology through high-throughput plastome engineering of Chlamydomonas reinhardtii. Inckemann R, Chotel T, Brinkmann CK, Burgis M, Andreas L, Baumann J, Sharma P, Klose M, Barrett J, Ries F, Paczia N, Glatter T, Willmund F, Mackinder LCM, Erb TJ. bioRxiv 2024.05.08.593163 10.1101/2024.05.08.593163