Skip to main content

pME_Cp_0_5_001_psbA_3'UTR_Cr
(Plasmid #235907)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 235907 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pME_Cp_UAV_GFP
  • Backbone size w/o insert (bp) 2101
  • Vector type
    Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    psbA 3'UTR
  • Species
    Chlamydomonas reinhardtii
  • Insert Size (bp)
    130

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (destroyed during cloning)
  • 3′ cloning site BsaI (destroyed during cloning)
  • 5′ sequencing primer CGTATCACGAGGCAGAATTTC
  • 3′ sequencing primer CCTGCATAACGCGAAGTAATC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2024.05.08.593163 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pME_Cp_0_5_001_psbA_3'UTR_Cr was a gift from Tobias Erb (Addgene plasmid # 235907 ; http://n2t.net/addgene:235907 ; RRID:Addgene_235907)
  • For your References section:

    Advancing chloroplast synthetic biology through high-throughput plastome engineering of Chlamydomonas reinhardtii. Inckemann R, Chotel T, Brinkmann CK, Burgis M, Andreas L, Baumann J, Sharma P, Klose M, Barrett J, Ries F, Paczia N, Glatter T, Willmund F, Mackinder LCM, Erb TJ. bioRxiv 2024.05.08.593163 10.1101/2024.05.08.593163