pME_Cp_0_7-8_006_Kan/ColEI_sfGFP
(Plasmid
#235972)
-
PurposeKanamycin/ColEI backbone with sfGFP placeholder for lvl2 assembly
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 235972 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepYTK084
- Backbone size w/o insert (bp) 1772
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameKan/ColEI
-
SpeciesAequoria victoria
-
Insert Size (bp)1036
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (destroyed during cloning)
- 3′ cloning site BsmBI (destroyed during cloning)
- 5′ sequencing primer CCTTTTTACGGTTCCTGGC
- 3′ sequencing primer CTCCTTCATTACAGAAACGGC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2024.05.08.593163 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pME_Cp_0_7-8_006_Kan/ColEI_sfGFP was a gift from Tobias Erb (Addgene plasmid # 235972 ; http://n2t.net/addgene:235972 ; RRID:Addgene_235972) -
For your References section:
A modular high-throughput approach for advancing synthetic biology in the chloroplast of Chlamydomonas. Inckemann RM, Chotel T, Burgis M, Brinkmann CK, Andreas L, Baumann J, Sharma P, Klose M, Barrett J, Ries F, Paczia N, Glatter T, Mackinder LCM, Willmund F, Erb TJ. Nat Plants. 2025 Nov;11(11):2332-2349. doi: 10.1038/s41477-025-02126-2. Epub 2025 Nov 3. 10.1038/s41477-025-02126-2 PubMed 41184475