pQdCas12a.empty
(Plasmid
#236036)
-
Purpose(Empty Backbone) The plasmid pQdCas12a.empty expresses the dCas12a endonuclease.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 236036 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepBBRMCS2
- Backbone size (bp) 10187
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsThe plasmid is stable in both 30 and 37 centigrade in E. coli. the plasmid is stable in 30 centigrade in P. putida.
-
Copy numberLow Copy
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer AGGATCTCGTCGTGACCCATG
- 3′ sequencing primer AAACGGAGGAATGGGAACG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pQdCas12a.empty was a gift from Radhakrishnan Mahadevan (Addgene plasmid # 236036 ; http://n2t.net/addgene:236036 ; RRID:Addgene_236036)