pQdCas12a.luxR(mut)-empty
(Plasmid
#236037)
-
PurposeThe plasmid pQdCas12a.luxR(mut)-empty expresses the dCas12a endonuclease. Additionally, it contains a mutation in the luxR gene.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 236037 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBBRMCS2
- Backbone size w/o insert (bp) 3913
- Total vector size (bp) 10186
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsthe plasmid is stable in both 30 and 37 centigrade in E. coli. the plasmid is stable in 30 centigrade in P. putida.
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namequorum sensing cassette luxI, mutated luxR, and the LuxR-dependent promoter pLuxI, dcas12a, and lacZ-alpha (fragment).
- Promoter quorum sensing promoter
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer AGGATCTCGTCGTGACCCATG
- 3′ sequencing primer AAACGGAGGAATGGGAACG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pQdCas12a.luxR(mut)-empty was a gift from Radhakrishnan Mahadevan (Addgene plasmid # 236037 ; http://n2t.net/addgene:236037 ; RRID:Addgene_236037) -
For your References section:
Model-Based Optimization of a qCRISPRi Circuit for Dynamic Control of Metabolic Pathways. Golla SA, Abo-Hashesh M, Gupta D, Liu Y, Mahadevan R. ACS Synth Biol. 2025 Oct 17;14(10):3890-3898. doi: 10.1021/acssynbio.5c00095. Epub 2025 Sep 29. 10.1021/acssynbio.5c00095 PubMed 41021780