Skip to main content

pQdCas12a.luxR(mut)-empty
(Plasmid #236037)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 236037 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pBBRMCS2
  • Backbone size w/o insert (bp) 3913
  • Total vector size (bp) 10186
  • Vector type
    CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    the plasmid is stable in both 30 and 37 centigrade in E. coli. the plasmid is stable in 30 centigrade in P. putida.
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    quorum sensing cassette luxI, mutated luxR, and the LuxR-dependent promoter pLuxI, dcas12a, and lacZ-alpha (fragment).
  • Promoter quorum sensing promoter

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer AGGATCTCGTCGTGACCCATG
  • 3′ sequencing primer AAACGGAGGAATGGGAACG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pQdCas12a.luxR(mut)-empty was a gift from Radhakrishnan Mahadevan (Addgene plasmid # 236037 ; http://n2t.net/addgene:236037 ; RRID:Addgene_236037)