POC1358
(Plasmid
#236103)
-
PurposeAssembled plasmid containing four inserts (from POC1343, POC1344, POC1345 and POC1346) assembled in POC1355
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 236103 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonePOC1355
-
Backbone manufacturerSelf-made
- Backbone size w/o insert (bp) 4357
- Total vector size (bp) 5269
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameDNA fragment flanked by BsaI sites
-
Alt nameMICA gene fragment modified
-
Insert Size (bp)912
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (unknown if destroyed)
- 3′ cloning site BsaI (unknown if destroyed)
- 5′ sequencing primer TGGTGTAAACAAATTGACGC
- 3′ sequencing primer ACGCCCTTTTAAATATCCG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
POC1358 was a gift from Christopher A. O'Callaghan (Addgene plasmid # 236103 ; http://n2t.net/addgene:236103 ; RRID:Addgene_236103) -
For your References section:
UniClo: scarless hierarchical DNA assembly without sequence constraint. Flores-Fernandez CN, Lin D, Robins K, O'Callaghan CA. Nucleic Acids Res. 2025 Jun 20;53(12):gkaf548. doi: 10.1093/nar/gkaf548. 10.1093/nar/gkaf548 PubMed 40548934