pQdCas9-sggfp
(Plasmid
#236184)
-
PurposeThe plasmid pQdCas9-sggfp expresses the dCas9 endonuclease and the sgRNA targeting the gfp gene.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 236184 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepBBRMCS2
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsThe plasmid is stable in both 30°C and 37°C in E. coli. The plasmid is stable in 30°C in P. putida.
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameQuorum sensing cassette luxI, luxR, and the LuxR-dependent promoter pLuxI , dCas9, and sgRNA for GFP gene
-
gRNA/shRNA sequencetgctcgagccctggaagtac
- Promoter Quorum sensing promoter
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer AGGATCTCGTCGTGACCCATG
- 3′ sequencing primer AAACGGAGGAATGGGAACG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pQdCas9-sggfp was a gift from Radhakrishnan Mahadevan (Addgene plasmid # 236184 ; http://n2t.net/addgene:236184 ; RRID:Addgene_236184)