Skip to main content

pQdCas9.luxR(mut)-sggfp
(Plasmid #236185)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 236185 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pBBRMCS2

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    The plasmid is stable in both 30°C and 37°C in E. coli. The plasmid is stable in 30°C in P. putida.
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Quorum sensing cassette luxI, mutated luxR, and the LuxR-dependent promoter pLuxI , dCas9, and sgRNA for GFP gene
  • gRNA/shRNA sequence
    tgctcgagccctggaagtac
  • Promoter Quorum sensing promoter

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer AGGATCTCGTCGTGACCCATG
  • 3′ sequencing primer AAACGGAGGAATGGGAACG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pQdCas9.luxR(mut)-sggfp was a gift from Radhakrishnan Mahadevan (Addgene plasmid # 236185 ; http://n2t.net/addgene:236185 ; RRID:Addgene_236185)
  • For your References section:

    Model-Based Optimization of a qCRISPRi Circuit for Dynamic Control of Metabolic Pathways. Golla SA, Abo-Hashesh M, Gupta D, Liu Y, Mahadevan R. ACS Synth Biol. 2025 Oct 17;14(10):3890-3898. doi: 10.1021/acssynbio.5c00095. Epub 2025 Sep 29. 10.1021/acssynbio.5c00095 PubMed 41021780