IMPT-11371
(Plasmid
#236191)
-
PurposeExpress GPR119 in insect cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 236191 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepFastBac1
-
Backbone manufacturergibco
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGPR119
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2709
-
Entrez GeneGPR119 (a.k.a. GPCR2)
- Promoter polyhedrin
Cloning Information
- Cloning method Gene Synthesis
- 5′ sequencing primer GGATTATTCATACCGTCCCA
- 3′ sequencing primer CAAATGTGGTATGGCTGATT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
IMPT-11371 was a gift from Vadim Cherezov (Addgene plasmid # 236191 ; http://n2t.net/addgene:236191 ; RRID:Addgene_236191) -
For your References section:
Native mass spectrometry prescreening of G protein-coupled receptor complexes for cryo-EM structure determination. Kim D, Liu W, Viner R, Cherezov V. Structure. 2024 Dec 5;32(12):2206-2219.e4. doi: 10.1016/j.str.2024.10.004. Epub 2024 Oct 28. 10.1016/j.str.2024.10.004 PubMed 39471802