IMPT-10917
(Plasmid
#236192)
-
PurposeExpress GPR6 in insect cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 236192 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA3.1(-)
-
Backbone manufacturerInvitrogen
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGPR6
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1311
-
Entrez GeneGPR6
- Promoter CMV
Cloning Information
- Cloning method Gene Synthesis
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
IMPT-10917 was a gift from Vadim Cherezov (Addgene plasmid # 236192 ; http://n2t.net/addgene:236192 ; RRID:Addgene_236192) -
For your References section:
Structural insights into the high basal activity and inverse agonism of the orphan receptor GPR6 implicated in Parkinson's disease. Barekatain M, Johansson LC, Lam JH, Chang H, Sadybekov AV, Han GW, Russo J, Bliesath J, Brice NL, Carlton MBL, Saikatendu KS, Sun H, Murphy ST, Monenschein H, Schiffer HH, Popov P, Lutomski CA, Robinson CV, Liu ZJ, Hua T, Katritch V, Cherezov V. Sci Signal. 2024 Dec 3;17(865):eado8741. doi: 10.1126/scisignal.ado8741. Epub 2024 Dec 3. 10.1126/scisignal.ado8741 PubMed 39626010