7AA-aSyn-pRK172
(Plasmid
#236197)
-
PurposeThis plasmid expresses human α-synuclein with a 7-amino acid insertion (MAAAEKT) in the pRK172 backbone for bacterial expression in E. coli. The insertion corresponds to the JOS mutation.
-
Depositing Labs
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 236197 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepRK172
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSNCA
-
SpeciesH. sapiens (human)
-
Insert Size (bp)444
-
Mutationinsertion os MAAAEKT at residue 22
-
Entrez GeneSNCA (a.k.a. NACP, PARK1, PARK4, PD1)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer CTGAGAAAACCATGGCAGCAGCAGAAAAGACTAAACAGGGTGTG
- 3′ sequencing primer CACACCCTGTTTGGCAGCAGCAGAAAAGACTATGGTTTTCTCAG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
7AA-aSyn-pRK172 was a gift from Sjors Scheres & Yang Yang (Addgene plasmid # 236197 ; http://n2t.net/addgene:236197 ; RRID:Addgene_236197) -
For your References section:
New SNCA mutation and structures of alpha-synuclein filaments from juvenile-onset synucleinopathy. Yang Y, Garringer HJ, Shi Y, Lovestam S, Peak-Chew S, Zhang X, Kotecha A, Bacioglu M, Koto A, Takao M, Spillantini MG, Ghetti B, Vidal R, Murzin AG, Scheres SHW, Goedert M. Acta Neuropathol. 2023 May;145(5):561-572. doi: 10.1007/s00401-023-02550-8. Epub 2023 Feb 27. 10.1007/s00401-023-02550-8 PubMed 36847833