rsZACRO/pRSETB
(Plasmid
#236200)
-
PurposeBacterial expression of rsZACRO, a positively reversibly photoswitchable fluorescent protein
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 236200 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepRSETB
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namersZACRO
-
SpeciesSynthetic
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer AGGATCTCGATCCCGCGAAATT
- 3′ sequencing primer TGCGGGCCTCTTCGCTATTA
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
rsZACRO/pRSETB was a gift from Takeharu Nagai (Addgene plasmid # 236200 ; http://n2t.net/addgene:236200 ; RRID:Addgene_236200) -
For your References section:
Positive-Type Reversibly Photoswitching Red Fluorescent Protein for Dual-Color Superresolution Imaging with Single Light Exposure for Off-Switching. Ozaki-Noma R, Wazawa T, Kakizuka T, Shidara H, Takemoto K, Nagai T. ACS Nano. 2025 Feb 25;19(7):7188-7201. doi: 10.1021/acsnano.4c16847. Epub 2025 Feb 12. 10.1021/acsnano.4c16847 PubMed 39937184