Skip to main content
Addgene

sgRNA Clec12a (CT6)
(Plasmid #236203)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 236203 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    L40C-CRISPR.EFS.dTomato (Plasmid #89392)
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    dTomato

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Clec12a
  • gRNA/shRNA sequence
    CCCCACATTTGTCAGACTTC
  • Species
    M. musculus (mouse)
  • GenBank ID
    NM_177686.4
  • Entrez Gene
    Clec12a (a.k.a. CLL-1, D230024O04, KLRL1, Micl, mKLRL1, mMICL)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (unknown if destroyed)
  • 3′ cloning site BsmBI (unknown if destroyed)
  • 5′ sequencing primer GACTATCATATGCTTACCGT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    sgRNA Clec12a (CT6) was a gift from Michael Heuser (Addgene plasmid # 236203 ; http://n2t.net/addgene:236203 ; RRID:Addgene_236203)
  • For your References section:

    Clec12a is required for the pathogenesis of NUP98::NSD1 AML. Mohanty S, Charles Cano F, Gabdoulline R, Lai CK, Othman B, Sudarsanam H, Eder T, Grebien F, Lipka DB, Henschler R, Heuser M. Blood Adv. 2025 May 7:bloodadvances.2024015739. doi: 10.1182/bloodadvances.2024015739. 10.1182/bloodadvances.2024015739 PubMed 40334081