sgRNA Clec12a (CT6)
(Plasmid
#236203)
-
Purposelentiviral expression of Cas9 and encodes CT6 sgRNA for CLEC12A deletion
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 236203 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneL40C-CRISPR.EFS.dTomato (Plasmid #89392)
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersdTomato
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameClec12a
-
gRNA/shRNA sequenceCCCCACATTTGTCAGACTTC
-
SpeciesM. musculus (mouse)
-
GenBank IDNM_177686.4
-
Entrez GeneClec12a (a.k.a. CLL-1, D230024O04, KLRL1, Micl, mKLRL1, mMICL)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (unknown if destroyed)
- 3′ cloning site BsmBI (unknown if destroyed)
- 5′ sequencing primer GACTATCATATGCTTACCGT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
sgRNA Clec12a (CT6) was a gift from Michael Heuser (Addgene plasmid # 236203 ; http://n2t.net/addgene:236203 ; RRID:Addgene_236203) -
For your References section:
Clec12a is required for the pathogenesis of NUP98::NSD1 AML. Mohanty S, Charles Cano F, Gabdoulline R, Lai CK, Othman B, Sudarsanam H, Eder T, Grebien F, Lipka DB, Henschler R, Heuser M. Blood Adv. 2025 May 7:bloodadvances.2024015739. doi: 10.1182/bloodadvances.2024015739. 10.1182/bloodadvances.2024015739 PubMed 40334081