pOET3-6xHis-hSMSr
(Plasmid
#236224)
-
PurposeExpress N-terminal His-tagged human SMSr (SAMD8) protein in insect cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 236224 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepOET3
-
Backbone manufacturerOxford Expression Technology
- Backbone size w/o insert (bp) 4542
- Total vector size (bp) 5790
-
Modifications to backbone6xHis tag are inserted
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSAMD8
-
Alt nameSphingomyelin synthase-related protein
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1248
-
Mutationwild type
-
Entrez GeneSAMD8 (a.k.a. HEL-177, SMSr)
-
Tags
/ Fusion Proteins
- Hexa histidine tag (6xHis-tag) (N terminal on insert)
- enterokinase site (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer GCTGATATCGGGAGTTCAGTCGTCGAATGC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pOET3-6xHis-hSMSr was a gift from Chiaki Murakami (Addgene plasmid # 236224 ; http://n2t.net/addgene:236224 ; RRID:Addgene_236224) -
For your References section:
Sphingomyelin synthase-related protein generates diacylglycerol via the hydrolysis of glycerophospholipids in the absence of ceramide. Murakami C, Sakane F. J Biol Chem. 2021 Jan-Jun;296:100454. doi: 10.1016/j.jbc.2021.100454. Epub 2021 Feb 20. 10.1016/j.jbc.2021.100454 PubMed 33621517