pAAV Jph3gRNA mEmerald hSyn mTagBFP2-CAAX2
(Plasmid
#236246)
-
PurposeEndogenous tagging of Junctophilin 3 with mEmerald with a fluorescent marker for the plasma membrane
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 236246 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAAV Syn intron Psam4GlyR m3m4 HA
-
Backbone manufacturerScott Sternson (Addgene plasmid # 196041)
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namegRNA for rat Jph3, mEmerald donor and mTagBFP2-CAAX2
-
gRNA/shRNA sequenceAGCCCCGAGCTGTACCGCAA
-
SpeciesSynthetic
-
Insert Size (bp)20
- Promoter U6 and human Synapsin1
-
Tag
/ Fusion Protein
- mTagBFP2 (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII/NheI (unknown if destroyed)
- 3′ cloning site XhoI/SacI (unknown if destroyed)
- 5′ sequencing primer hU6-F
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV Jph3gRNA mEmerald hSyn mTagBFP2-CAAX2 was a gift from Jennifer Lippincott-Schwartz (Addgene plasmid # 236246 ; http://n2t.net/addgene:236246 ; RRID:Addgene_236246) -
For your References section:
Periodic ER-plasma membrane junctions support long-range Ca(2+) signal integration in dendrites. Benedetti L, Fan R, Weigel AV, Moore AS, Houlihan PR, Kittisopikul M, Park G, Petruncio A, Hubbard PM, Pang S, Xu CS, Hess HF, Saalfeld S, Rangaraju V, Clapham DE, De Camilli P, Ryan TA, Lippincott-Schwartz J. Cell. 2025 Jan 23;188(2):484-500.e22. doi: 10.1016/j.cell.2024.11.029. Epub 2024 Dec 20. 10.1016/j.cell.2024.11.029 PubMed 39708809