Skip to main content

pAAV Jph3gRNA mEmerald hSyn mTagBFP2-CAAX2
(Plasmid #236246)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 236246 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pAAV Syn intron Psam4GlyR m3m4 HA
  • Backbone manufacturer
    Scott Sternson (Addgene plasmid # 196041)
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    gRNA for rat Jph3, mEmerald donor and mTagBFP2-CAAX2
  • gRNA/shRNA sequence
    AGCCCCGAGCTGTACCGCAA
  • Species
    Synthetic
  • Insert Size (bp)
    20
  • Promoter U6 and human Synapsin1
  • Tag / Fusion Protein
    • mTagBFP2 (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII/NheI (unknown if destroyed)
  • 3′ cloning site XhoI/SacI (unknown if destroyed)
  • 5′ sequencing primer hU6-F
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV Jph3gRNA mEmerald hSyn mTagBFP2-CAAX2 was a gift from Jennifer Lippincott-Schwartz (Addgene plasmid # 236246 ; http://n2t.net/addgene:236246 ; RRID:Addgene_236246)
  • For your References section:

    Periodic ER-plasma membrane junctions support long-range Ca(2+) signal integration in dendrites. Benedetti L, Fan R, Weigel AV, Moore AS, Houlihan PR, Kittisopikul M, Park G, Petruncio A, Hubbard PM, Pang S, Xu CS, Hess HF, Saalfeld S, Rangaraju V, Clapham DE, De Camilli P, Ryan TA, Lippincott-Schwartz J. Cell. 2025 Jan 23;188(2):484-500.e22. doi: 10.1016/j.cell.2024.11.029. Epub 2024 Dec 20. 10.1016/j.cell.2024.11.029 PubMed 39708809