pSpCas9(BB)-2A-puro-mAnkrd11 (intron 3)
(Plasmid
#236608)
-
PurposeKnockouts Ankrd11 in mouse cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 236608 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSpCas9(BB)-2A-Puro
- Backbone size w/o insert (bp) 9147
- Total vector size (bp) 9177
-
Vector typeMammalian Expression, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAnkrd11
-
Alt nameAnco1
-
gRNA/shRNA sequenceTCAACAGCCCCTCCTGTTCT
-
SpeciesM. musculus (mouse)
-
Entrez GeneAnkrd11 (a.k.a. 2410104C19Rik, 3010027A04Rik, 6330578C09Rik, 9530048I21Rik, Gm176, Yod)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer GAGGGCCTATTTCCCATGATTCC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSpCas9(BB)-2A-puro-mAnkrd11 (intron 3) was a gift from Tadashi Nakagawa (Addgene plasmid # 236608 ; http://n2t.net/addgene:236608 ; RRID:Addgene_236608) -
For your References section:
KBG syndrome-associated protein ANKRD11 regulates SETD5 expression to modulate rRNA levels and translation. Sashiyama S, Nakagawa T, Nakagawa M, Hosogane M, Watanabe Y, Ashitomi H, Yamane K, Shibuya N, Moroishi T, Nakayama K, Hosoi T. iScience. 2025 May 19;28(6):112699. doi: 10.1016/j.isci.2025.112699. eCollection 2025 Jun 20. 10.1016/j.isci.2025.112699 PubMed 40520101