Skip to main content

pSpCas9(BB)-2A-puro-mAnkrd11 (intron 4)
(Plasmid #236609)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 236609 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSpCas9(BB)-2A-Puro
  • Backbone size w/o insert (bp) 9147
  • Total vector size (bp) 9177
  • Vector type
    Mammalian Expression, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Ankrd11
  • Alt name
    Anco1
  • gRNA/shRNA sequence
    TCGGACACAGGTACCAGACT
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Ankrd11 (a.k.a. 2410104C19Rik, 3010027A04Rik, 6330578C09Rik, 9530048I21Rik, Gm176, Yod)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer GAGGGCCTATTTCCCATGATTCC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSpCas9(BB)-2A-puro-mAnkrd11 (intron 4) was a gift from Tadashi Nakagawa (Addgene plasmid # 236609 ; http://n2t.net/addgene:236609 ; RRID:Addgene_236609)
  • For your References section:

    KBG syndrome-associated protein ANKRD11 regulates SETD5 expression to modulate rRNA levels and translation. Sashiyama S, Nakagawa T, Nakagawa M, Hosogane M, Watanabe Y, Ashitomi H, Yamane K, Shibuya N, Moroishi T, Nakayama K, Hosoi T. iScience. 2025 May 19;28(6):112699. doi: 10.1016/j.isci.2025.112699. eCollection 2025 Jun 20. 10.1016/j.isci.2025.112699 PubMed 40520101