pCMV5D HA-PPM1M_H flap
(Plasmid
#236719)
-
PurposeExpresses PPM1M with PPM1H flap domain sequence
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 236719 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCMV5D_H flap
- Backbone size w/o insert (bp) 4987
- Total vector size (bp) 6400
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePPM1M_H flap
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1413
-
MutationPPM1M flap domain replaced with PPM1H flap domain
-
Entrez GenePPM1M (a.k.a. PP2C-eta, PP2CE, PP2Ceta)
-
Entrez GenePPM1H (a.k.a. ARHCL1, NERPP-2C, URCC2)
- Promoter CMV
-
Tag
/ Fusion Protein
- HA (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2025.03.19.644182 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV5D HA-PPM1M_H flap was a gift from Suzanne Pfeffer (Addgene plasmid # 236719 ; http://n2t.net/addgene:236719 ; RRID:Addgene_236719) -
For your References section:
PPM1M, a LRRK2-counteracting, phosphoRab12-preferring phosphatase with potential link to Parkinson’s disease. Claire Y. Chiang, Neringa Pratuseviciute, Yu-En Lin, Ayan Adhikari, Wondwossen M. Yeshaw, Chloe Flitton, Pemba L. Sherpa, Francesca Tonelli, Irena Rektorova, Timothy Lynch, Joanna Siuda, Monika Rudzińska-Bar, Oleksandr Pulyk, Peter Bauer, Christian Beetz, Dennis W. Dickson10, Owen A. Ross, Zbigniew K. Wszolek, Christine Klein, Alexander Zimprich, Dario R. Alessi, Esther M. Sammler and Suzanne R. Pfeffer. bioRxiv, 2025 10.1101/2025.03.19.644182