His-SUMO-Rab10 Q68L
(Plasmid
#236720)
-
PurposeExpresses Rab10 Q68L with His tag and SUMO cleavage sequence
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 236720 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepET15b+
- Backbone size w/o insert (bp) 5654
- Total vector size (bp) 6563
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRab10 Q68L
-
SpeciesH. sapiens (human)
-
Insert Size (bp)912
-
MutationQ68L
-
Entrez GeneRAB10
- Promoter T7
-
Tag
/ Fusion Protein
- 6xHis-SUMO (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
His-SUMO-Rab10 Q68L was a gift from Suzanne Pfeffer (Addgene plasmid # 236720 ; http://n2t.net/addgene:236720 ; RRID:Addgene_236720) -
For your References section:
PPM1M, a LRRK2-counteracting, phosphoRab12-preferring phosphatase with potential link to Parkinson’s disease. Claire Y. Chiang, Neringa Pratuseviciute, Yu-En Lin, Ayan Adhikari, Wondwossen M. Yeshaw, Chloe Flitton, Pemba L. Sherpa, Francesca Tonelli, Irena Rektorova, Timothy Lynch, Joanna Siuda, Monika Rudzińska-Bar, Oleksandr Pulyk, Peter Bauer, Christian Beetz, Dennis W. Dickson10, Owen A. Ross, Zbigniew K. Wszolek, Christine Klein, Alexander Zimprich, Dario R. Alessi, Esther M. Sammler and Suzanne R. Pfeffer. bioRxiv, 2025 10.1101/2025.03.19.644182