pLenti_DualsgRNA_CTRL_ER-dAPEX-BFP2
(Plasmid
#236733)
-
PurposeDual sgRNA targeting CTRL expressing dAPEX-BFP targeting to ER
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 236733 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLenti_DualsgRNA_CTRL_Puro_T2A_BFP2
-
Backbone manufacturerDerek Narendra, Addgene plasmid #236730
-
Modifications to backbonepLenti_DualsgRNA_CTRL_Puro_T2A_BFP2 was cut with EcoRI and NheI then NEBuilder reaction was done with dAPEX-BFP2 insert.
-
Vector typeLentiviral, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameNegative CTRL
-
gRNA/shRNA sequenceGCCGTGGGCAACACTGTAT, GCGTTGGCACTTAGCGCAGC
-
SpeciesH. sapiens (human)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2025.02.19.639160 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti_DualsgRNA_CTRL_ER-dAPEX-BFP2 was a gift from Derek Narendra (Addgene plasmid # 236733 ; http://n2t.net/addgene:236733 ; RRID:Addgene_236733) -
For your References section:
A unified mechanism for mitochondrial damage sensing in PINK1-Parkin-mediated mitophagy. Thayer JA, Petersen JD, Huang X, Gruel Budet LM, Hawrot J, Ramos DM, Sekine S, Li Y, Ward ME, Narendra DP. EMBO J. 2025 Nov 20. doi: 10.1038/s44318-025-00604-z. 10.1038/s44318-025-00604-z PubMed 41266657