pBOB-3xFlag-hGpr75-p.Ala110fs
(Plasmid
#236747)
-
PurposeExpress 3xFlag N-terminal tagged human GPR75 p.Ala110fs mutant transiently via transfection or stably via lentivirus-mediated infection in mammalian cells.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 236747 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBOB
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGPR75
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1616
-
MutationAla110fs, deletion of GCCAGTA
-
GenBank IDNM_006794
-
Entrez GeneGPR75 (a.k.a. GPRchr2, WI31133)
-
Tag
/ Fusion Protein
- 3xFlag (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer agctcgtttagtgaaccgtcagatcg
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBOB-3xFlag-hGpr75-p.Ala110fs was a gift from Zhao Zhang (Addgene plasmid # 236747 ; http://n2t.net/addgene:236747 ; RRID:Addgene_236747) -
For your References section:
Central regulation of feeding and body weight by ciliary GPR75. Jiang Y, Xun Y, Zhang Z. J Clin Invest. 2024 Aug 13;134(19):e182121. doi: 10.1172/JCI182121. 10.1172/JCI182121 PubMed 39137039