pCMV-BirA-HA-Tulp3
(Plasmid
#236749)
-
PurposeExpress BirA and HA tagged TULP3 transiently via transfection in mammalian cells.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 236749 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCMV
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTulp3
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1383
-
GenBank IDNM_011657
-
Entrez GeneTulp3 (a.k.a. 2310022L06Rik)
-
Tags
/ Fusion Proteins
- BirA (N terminal on backbone)
- HA (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer TCTAAAAGCTGCGGAATTGT
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV-BirA-HA-Tulp3 was a gift from Zhao Zhang (Addgene plasmid # 236749 ; http://n2t.net/addgene:236749 ; RRID:Addgene_236749) -
For your References section:
Central regulation of feeding and body weight by ciliary GPR75. Jiang Y, Xun Y, Zhang Z. J Clin Invest. 2024 Aug 13;134(19):e182121. doi: 10.1172/JCI182121. 10.1172/JCI182121 PubMed 39137039