pGL3-MRE/CRE/SRE
(Plasmid
#236751)
-
PurposeUse as a MRE/CRE/SRE reporter for luciferase assays to measure GPCR activation.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 236751 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepGL3
-
Vector typeLuciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMRE/CRE/SRE
-
SpeciesSynthetic
-
Insert Size (bp)437
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SacI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer CTAGCAAAATAGGCTGTCCC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGL3-MRE/CRE/SRE was a gift from Zhao Zhang (Addgene plasmid # 236751 ; http://n2t.net/addgene:236751 ; RRID:Addgene_236751) -
For your References section:
Central regulation of feeding and body weight by ciliary GPR75. Jiang Y, Xun Y, Zhang Z. J Clin Invest. 2024 Aug 13;134(19):e182121. doi: 10.1172/JCI182121. 10.1172/JCI182121 PubMed 39137039