PB-2G-CNCB
(Plasmid
#236764)
-
Purpose(Empty Backbone) A piggybac-based cloning vector containing dual sgRNAs for spCas9 and CAG promoter-driven nuclear-localized Clover-T2A-BSR.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 236764 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonePB-U6-CNCB
-
Backbone manufacturerSynthetic
- Backbone size (bp) 8339
-
Modifications to backboneThe hU6-BbsI stuffer-CR3 fragment was inserted into the SfiI/PstXI site of PB-U6-CNCB.
-
Vector typeMammalian Expression ; PiggyBac
- Promoter mouse U6 promoter, human U6 promoter, CAG promoter
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer GAGGCTTAATGTGCGATAAAAGA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PB-2G-CNCB was a gift from Kazutoshi Takahashi (Addgene plasmid # 236764 ; http://n2t.net/addgene:236764 ; RRID:Addgene_236764) -
For your References section:
EIF3D safeguards the homeostasis of key signaling pathways in human primed pluripotency. Okubo C, Nakamura M, Sato M, Shichino Y, Mito M, Takashima Y, Iwasaki S, Takahashi K. Sci Adv. 2025 Apr 11;11(15):eadq5484. doi: 10.1126/sciadv.adq5484. Epub 2025 Apr 9. 10.1126/sciadv.adq5484 PubMed 40203091