SB-CAG-mCherry-P2A-EIF3D-IP
(Plasmid
#236769)
-
PurposeA sleeping beauty-based vector containing CAG promoter-driven mCherry-P2A-EIF3D-IRES-Pac.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 236769 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneSB-CAG-mCherry-IP
-
Backbone manufacturerSynthetic
- Backbone size w/o insert (bp) 7467
- Total vector size (bp) 9114
-
Vector typeMammalian Expression ; Sleeping beauty
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameEIF3D
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1647
-
GenBank IDNM_003753.4
-
Entrez GeneEIF3D (a.k.a. EIF3S7, eIF3-p66, eIF3-zeta)
- Promoter CAG promoter
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CACCGGCGGCATGGACGAGCTG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
SB-CAG-mCherry-P2A-EIF3D-IP was a gift from Kazutoshi Takahashi (Addgene plasmid # 236769 ; http://n2t.net/addgene:236769 ; RRID:Addgene_236769) -
For your References section:
EIF3D safeguards the homeostasis of key signaling pathways in human primed pluripotency. Okubo C, Nakamura M, Sato M, Shichino Y, Mito M, Takashima Y, Iwasaki S, Takahashi K. Sci Adv. 2025 Apr 11;11(15):eadq5484. doi: 10.1126/sciadv.adq5484. Epub 2025 Apr 9. 10.1126/sciadv.adq5484 PubMed 40203091