PB-TRE3G-TP53-CCRB
(Plasmid
#236773)
-
PurposeA piggybac-based cloning vector containing TRE3G promoter-driven full-length TP53 and CAG promoter-driven nuclear-localized Clover-P2A-rtTA-IRES-BSD.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 236773 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonePB-TRE3G-CCRB
-
Backbone manufacturerSynthetic
- Backbone size w/o insert (bp) 10420
- Total vector size (bp) 11602
-
Vector typeMammalian Expression ; PiggyBac
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTP53
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1182
-
GenBank IDNM_000546.6
-
Entrez GeneTP53 (a.k.a. BCC7, BMFS5, LFS1, P53, TRP53)
- Promoter TRE3G promoter
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer TTAGTGAACCGTCAGATCGCCT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The C to G SNP (rs1042522) in the in TP53 insert makes the coding amino acid change from proline to arginine (p.P72R). This SNP is common in all world populations.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PB-TRE3G-TP53-CCRB was a gift from Kazutoshi Takahashi (Addgene plasmid # 236773 ; http://n2t.net/addgene:236773 ; RRID:Addgene_236773) -
For your References section:
EIF3D safeguards the homeostasis of key signaling pathways in human primed pluripotency. Okubo C, Nakamura M, Sato M, Shichino Y, Mito M, Takashima Y, Iwasaki S, Takahashi K. Sci Adv. 2025 Apr 11;11(15):eadq5484. doi: 10.1126/sciadv.adq5484. Epub 2025 Apr 9. 10.1126/sciadv.adq5484 PubMed 40203091